SmokeyRN SmokeyRN
  • 02-05-2018
  • Physics
contestada

I’m still not sure on this one please help

Im still not sure on this one please help class=

Respuesta :

shadow37 shadow37
  • 02-05-2018
The answer c for your question
Answer Link

Otras preguntas

Find the approximated area of a circle whose circumference is 7.85.
I am needing help. I do not understand these types of problems.
Which of the numbers 12, 13, or 14 is the solution of 106 = 118 - x?
there is a step missing from the solution. Which equation is the missing step?
show your stepsWhat is the solution of the equation?SEE IMAGE
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.
simplify 7.5y⁴ • 9y²
Tools - Question 4 The coordinate planle below shows the location of segment QR. 109Y 5 Q1-4,3) 70-9-8-7-6-5-4-3-3 2 3 4 5 6 7 8 9 TU R(8,-6) What is the unit d
A gift box for a shirt has a length of 45 centimeters, a width of 30 centimeters, anda height of 8 centimeters. Find the surface area of the gift box
Find the mean of these numbers: 5, 11, 2, 12, 4, 2Need solution :Dhave a good night ^^ from Philippines