quirkykayden9044 quirkykayden9044

01-12-2017
Social Studies

contestada

The original basis of most legal systems today is roman law.
a. True
b. False

Respuesta :

Аноним Аноним

01-12-2017

i believe the answer is true but i'm not completely sure.

Answer Link

Otras preguntas

Can someone please explain this?

A marketing manager had a goal to improve market share for his paper plates by 2 percent in the coming year, and he felt he’d need to run television ads for two

Lily's car used 5 gallons of gas to drive 230 miles. At what rate does her care use gas in gallons per mile?

Name an organism in each domain: archaea, bacteria, eukarya

Resorts Corp. common stock is selling for $36.75 a share and has a dividend yield of 2.3 percent. What is the dividend amount?

in a class of 145 students 92 are taking math 73 are taking science and 51 are taking both math and science. One student is picked at random. Find the probabili

Why is flexibility important for new parents?

ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled to the dephosphorylation of ATP? A. the exergonic hydrolys

Trudy writes an expression to calculate the mass defect of a carbon-14 nucleus using the symbols in the table. A 2 column table with 4 rows. The first column is

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template