charliesabeastoyr5vj charliesabeastoyr5vj

01-11-2017
Mathematics

contestada

Dan has 4 over 5 cup of ice cream. How many 1 over 8-cup servings are in 4 over 5 cup of ice cream?

Respuesta :

FrozenApex FrozenApex

01-11-2017

4/5 ÷ 1/8
6.4 servings of 1/8 will be in the cup

Answer Link

01-11-2017

I believe the answer is 6.05

Hope it helps.

Answer Link

Otras preguntas

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

The diluted ink used with a brush to create various tones or values is called a _______ (blank).

Can you find the conditional sentences? A lo largo de esta canción hay varias oraciones condicionales. Rellena la tabla con las oraciones condicionales que apar

The Fed uses open market operations by buying and selling . The rate at which banks lend money and charge one another for storing money in the Fed is known as

16. Anxiety is different from fear in that it does not activate the autonomic nervous system. A. True B. False

grapes cost $2.50 per pound. which equation represents y, the total cost of grapes at x pounds? shoe explanation please

1. 5x + 2 = 27how to work backwards on this type of problem

Factor: 6a²−378a²−384a.

A. If the bank provides an annual percentage yield of 3.2%, what will be the balance when lucy turns 1? turns 2? turns 3?

Find the area of a regular hexagon with an apothem of 15cm