bobbiediane5960 bobbiediane5960
  • 03-10-2017
  • Biology
contestada

What is responsible for determining which direction water will diffuse across the plasma membrane of cells?

Respuesta :

MINDY3574 MINDY3574
  • 03-10-2017
Tonicity is responsible for determining which direction water will diffuse across the plasma membrane of cells.
Answer Link

Otras preguntas

what are 2 points on the graph for 6x-5y=25
Round 46.895 to the nearest tenth
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
How do you write fifty-seven thousand,eighteen. In standard form
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Graph the six terms of a finite series where a1 = -3 and r = 1.5.