26wigtyr 26wigtyr

04-03-2022
History

contestada

What did General Sherman say he was doing on his way through Georgia?

Respuesta :

4726980 4726980

04-03-2022

Answer:

In his own words, Sherman intended to “make Georgia howl,” I don't know if this helps but i hope it helps

Explanation:

Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

Gail needs 9 yards of fabric for a quilt. How many different patterns of fabric does she need if she buys of a yard of each pattern? patterns

Aubree invested $1,000 in an account paying an interest rate of 6\tfrac{1}{4}6 4 1 % compounded daily. Mia invested $1,000 in an account paying an interest ra

Can someone help with number 13 ? I will give a brainly !!

A trapezoid is plotted on the coordinate plane What are the new coordinates of the trapezoid after it is rotated 180° clockwise about the origin?

Which can be used to find the partial sum of the first 12 terms?

What is the only intermolecular force present in nonpolar compounds?

If an element forms a 2+ ion, in which group of the periodic table would you expect to find it? A. 2 B. 1 O c. 17 D. 18

75% of what number is 27? EXPLAIN

Please help me with this one question?!!!!