blaidonertel
blaidonertel blaidonertel
  • 03-03-2022
  • Social Studies
contestada

Is south korea in east asia?​

Respuesta :

jayciertel09
jayciertel09 jayciertel09
  • 03-03-2022

Answer:

Yes, it is. including China, Hong Kong, Japan, Macau, Mongolia, North Korea, and Taiwan. Have a great day and I hope this helps!

Answer Link
skylar7374
skylar7374 skylar7374
  • 03-03-2022
South Korea is located in east Asia
Answer Link

Otras preguntas

Who is the most likely intended audience for Stanton's declaration? A. all men B. all women C. men in public office D. women in public office E. men and women i
Determine the molecular weight of H2O. 189 18.0 g 18.019 18.016 9
A 38000-Mg ocean liner has an initial velocity of 4 km/h. Neglecting the frictional resistance of the water, determine the time required to bring the liner to
Paint that uses a vehicle made of wax is called _______
9. Richard wants to start a college savings account forhis daughter. Which would be helpful advice to giveRichard in order to help him maximize his savingsamoun
25 points I swear just help me this How did Muybridge's work influence painters like Thomas Eakins?
(7x2 + 4x + 10) - (3x2 + 2x - 6)
How many moles are contained in 1.44 x 10^23 molecules of water?
What landform covers much of central India?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA