archnaverma11
archnaverma11 archnaverma11
  • 03-01-2022
  • Mathematics
contestada

factorise 16 x²+ 4 y² + 9 z²​

Respuesta :

howtobesad howtobesad
  • 03-01-2022

Answer:

The expression is not factorable with rational numbers.

Step-by-step explanation:

Answer Link

Otras preguntas

What was religion like in Shang China?
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
What kind of problems did increased urbanization cause? During time of industrial revolution
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y