luleydm luleydm
  • 02-09-2021
  • Mathematics
contestada

please help!!!!!
what is -x+2x???

Respuesta :

ivvvivivi
ivvvivivi ivvvivivi
  • 02-09-2021
The answer is X

Hope this helps!
Answer Link
heyy133abc heyy133abc
  • 02-09-2021
The answer is. X good luck in math wishing u the best luck!
Answer Link

Otras preguntas

When a number is increased by 48%, the result is 92. What is the original number to the nearest tenth?
how do I solve this equation using the substitution method? They want me to isolate x in the first equation. x + 3y = -5 4x - y = -33
PLEASE ANSWER a seed was discovered and when planted grew to be a large flower. A) archaea B) bacteria C) Eukarya
what is the lowest common denominator for 5/8 and 4/6​
A bicycle tire is spinning clockwise at 2.50 rad/s. During a time period Dt 5 1.25 s, the tire is stopped and spun in the oppo- site (counterclockwise) directio
match the correct y=mx+b equation to the graph: pls show work/explanation!
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
The budgeted production of Capricorn, Inc. is 10,000 units per month. Each unit requires 20 minutes of direct labor to complete. The direct labor rate is $100 p
Solve for x. Round to the nearest tenth
Is the existence of Pangea a reasonable idea?