4792255 4792255
  • 01-09-2021
  • Mathematics
contestada

The 100th term of the pattern : 5 , 9 ,13 , 17.

Respuesta :

bobosamuelpale
bobosamuelpale bobosamuelpale
  • 01-09-2021

Answer:

Tn=4n+1

4(100)+1

400+1

=401

Answer Link

Otras preguntas

factor completely: 21a+27
What is the range for this set of data? 7, 15, 12
12x+9−20x HELP ME PLEASE
An angle measures 136° less than the measure of its supplementary angle. What is the measure of each angle?
michelangelo drawings which one is your favorite and why
Which of the following events that took place in the years preceding the Revolutionary War represented the most significant action on the part of the colonists
The following information pertains to Dallas Company. Assume that all balance sheet amounts represent both average and ending balance figures and that all sales
[tex] 24{ \times }^{2} + 25 \times - 47 = - 8 \times - 3 - 53 [/tex]please help​
Homeschooling my little brother this is so complicated. I was already helped with the 1st one can anyone help me with more. Much appreciated.
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template