ivanelmer ivanelmer

02-04-2021
English

contestada

Write an original sentence using the word stagnant

Respuesta :

komarucore komarucore

02-04-2021

Answer:

Today I was tired and quite stagnant, there hasn't been things to do today! All I wanted to do was nap.

Answer Link

ariellerood3 ariellerood3

02-04-2021

As there was nothing planned for today, I was very stagnant and bored.

Answer Link

Otras preguntas

BC is parallel to DE What is AC? Enter your answer in the box.

What are two concepts of government democracy?

Which biomolecule is primarily responsible for providing you with energy?

What did president wilson's wife make sure was on the white house lawn?

4/y+2 - 9/y-2 = 9/y^2-4

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

When a red blood cell is placed in hypertonic (very concentrated) solutions of nacl?

Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3

Los deportistas profesionales ____ el pago por si desempeño. recibe reciben reciban reciba

you rent a well-lit flat in philidelpia for $1,080 per month. your landlord, knowing that new apatments are being built nearby, decreases you rent by 3%each yea