packersch2004 packersch2004
  • 03-02-2021
  • History
contestada

7. What role, if any, should the federal government play in addressing economic and so
problems?

Respuesta :

isablquiroz1120
isablquiroz1120 isablquiroz1120
  • 03-02-2021

Answer: I think The U.S. government is already working to address income inequality and poverty. Some people believe that the government should be doing more, some believe it should be doing less, and some feel that the current role is about right.

Explanation:

Answer Link

Otras preguntas

One spring day, William noted the time of day and the temperature, in degrees Fahrenheit. His findings are as follows: At 6 a.m., the temperature was 52° F. For
why did hamilton oppose term limits for certain government officials?
How many people participate in the u.s government
I'M GOING TO GIVE THE CROWN Most countries in the world rely on a unitary system of government. Why do you think that'a the case?​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
first answer right gets brainlyest
Culture is the sum of the___and___ that a group of people share. A. Location;resources B. Beliefs;behaviors C. Museums;opera D. Clothing;food help me pls
PENN FOSTER STUDENT!! The MOST significant influence on the life and art of Eugene Boudin was his A: relationship with the Pre-Raphaelites. B: love of the city
please help it’s due tmr
Does health care affect you, your family friends and or your community?