peeplol88
peeplol88 peeplol88
  • 03-12-2020
  • Mathematics
contestada

$210 watch; 20% discount

Respuesta :

sxmpx sxmpx
  • 03-12-2020

Answer:

$168

Step-by-step explanation:

Answer Link
thegreatcatlord101
thegreatcatlord101 thegreatcatlord101
  • 03-12-2020

Answer:

20% = 0.20

0.20 x 210 = $42

$42 discount

210 - 42 = 168

Your total amount you would pay would be $168. The discount is $48.

Answer Link

Otras preguntas

Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not
Triangle abc has vertices a(0 0) b(6 8) and c(8 4). which equation represents the perpendicular bisector of bc
what does the constitution state about the interaction of the judicial branch and new laws
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
-( x + 4 ) = 2x + 35
14. Find the coordinates of the circumcenter for ∆DEF with coordinates D(1,3) E (8,3) and F(1,-5). Show your work.
Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90
What name was given to the fight over slavery in the Kansas territory in the mid-1800’s?
what are the zeros of the polynomial x2+4x-12
Attorney general a. mitchell palmer believed that he needed to protect the american people from