EviB123 EviB123
  • 02-10-2020
  • Physics
contestada

What is the transfer of electricity to generator?

Respuesta :

letikrabs1234
letikrabs1234 letikrabs1234
  • 02-10-2020
A generator transfer switch closes off the utility power line to your home's electrical system during a power outage and opens a line to a generator, then reverses the process when grid power is restored
Answer Link

Otras preguntas

in what area of Europe were the majority of warsaw pact countries
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
what was paul revere failures
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
how do you say theatre in Spanish
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
what rule does static electricity follow