cieralanes2008 cieralanes2008
  • 01-10-2020
  • Mathematics
contestada

Gemma had 25.75 grams of frosting to make a cake. She decided to use only 15.5 grams of the frosting. How much frosting does Gemma have left?​

Respuesta :

mhanifa
mhanifa mhanifa
  • 01-10-2020

Answer:

  • 10.2 grams

Step-by-step explanation:

Gemma had 25.75 grams of frosting

Used 15.5 grams

Left over:

  • 25.75 - 15.5 = 10.2 grams
Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
Please help, I need it ASAPWill give brainliest to first answer.
Today, the continents of Europe and Asia and the subcontinent of India form a single landmass. True or false? I chose Biology even though this is science, becau
Describe the first governments created in the United States. What do you think we're the most important aspects of these early national governments?
What is a cellular structure that performs a specific function in the cell?
What is the ratio of H+ ions to OH– ions at a pH = 11? 100000000 :1, OR 1:
FACTORISE COMPLETELY 4y^2 + 16y
Increasing temperature adds more energy. Which increases ________. O Kinetic Energy O Potential Energy O Explosions
What is the primary factor that determines what a star's life path will be? Its brightness Its mass Its temperature Its distance fro
Please help asap!!!!!!!