travannaht3080 travannaht3080

01-06-2019
English

contestada

Select the correct answer from each drop-down menu. Why did Henry VIII seek a separation from the Catholic Church?

Respuesta :

Lizzz19 Lizzz19

01-06-2019

Answer: Henry VII sought for a separation from the Catholic church because the church didn't support him in his wanting to divorce Catherine of Aragon.

Answer Link

sarahbenson234 sarahbenson234

20-01-2021

Answer:

B and C

Explanation:

Answer Link

Otras preguntas

Some students are investigating how a liquid cools over time after heating it to different temperatures. They create the graph below from their collected data.

help pleaseeee i’ll give a brainliest to the person with the correct answer

I need an answer please

What factors contributed to both the northern victory and southern defeat during the American civil war ?

The melting of a glacier is an example of the interactions among which of Earth’s spheres? geosphere, troposphere, cryosphere atmosphere, geosphere, cryosphere

Help pls! (4c+4)(2c-3)

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

can you write a summary about cells

what is the length of 5cm

A person swims the length of the pool, from Point X to Point Y. They complete this lap in 10 seconds. What is the speed of the swimmer? A 15 m/s B 5 m/s C 50