02-05-2019
Mathematics

contestada

g(x)=4+1 what is g(3)

Respuesta :

MrsStrong MrsStrong

02-05-2019

Answer:

13

Step-by-step explanation:

Assuming g(x)=4x+1, then g(3) is 4(3)+1=12+1=13. So g(3)=13.

Answer Link

Otras preguntas

Solve this system using Substitution y=5x - 16x + 2y = 14

Which expressions are equivalent to the one below? Check all that apply.log(103)A.3 • log 10B.1C.3 • 10D.3

Hello! I need some help with this homework question, please? The question is posted in the image below. Q14

Decompositionof ammonium nitrate produces water and di nitrogen oxide. a) Predict how many grams of water will be produced from decomposition of 0.555 kg of amm

A sled is initially at rest at the top of a hill at an elevation 55.0 m higher than the elevation at the bottom. Find the speed of the sled after it slides with

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

I need to know what goes in the boxes for this practice question.

Data/Research:Mass: _ 1 kgMaterial: CopperInitial temperature (Ti measure in °C): _330°Final temperature (T, measure in ºc): 3300at*C.Specific heat (c value mea

2 points6. Which system of questions can be used to find the number of smallboxes, x, and the number of large boxes, y, on the pallet?*Small boxes and large box

Which inequality represents all values of x for which the quotient below isdefined?√x+2 / √5-x/ = division